Not really. Delivering gene edits via CRISPR in this way is more like editing a text file with a single application of a regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.
TIL my years of perl regex'ing was preparing me for a future of DNA gene warfare
(core war, anybody?)
So, Perl or sed. If it's Perl, the guy from XKCD was right. And, maybe, Larry Wall.