fwip 1 day ago

Not really. Delivering gene edits via CRISPR in this way is more like editing a text file with a single application of a regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.

2
xarope 17 hours ago

TIL my years of perl regex'ing was preparing me for a future of DNA gene warfare

(core war, anybody?)

anthk 1 day ago

So, Perl or sed. If it's Perl, the guy from XKCD was right. And, maybe, Larry Wall.